Public Note:
ITS>AGTTCAGCAGGTAGTCTCACCTGATTTGAGGTCANGATTTTATTTTATATGGGTCTAGCTGTCCACTAATATAAATAGCAAAAACCAGAAGCACCATTATTGTCTATAAGACAGTTAGAAGCAGGCATCTAAAAGACAATGCTAAATCCAAAATGTAGAAGCATCTTATCACATTAAGAATCAGCAAAGCAGACCCTACTAATTTATTTTAGAGGAGCTTGCTTCCGTCACAAAAGCAAGCATTAAAACCTCCAAGTCCAAAAGCCTTTTCCTGACCAGAAACGATCAAACAAAAAAGGTTTTTGAGGATTTCACGACACTCAAACAGGTGTGCCCCTCGGAATGCCAAGGGGCGCAAGTTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGTTGAAAGTTGTATTAATTGCATATAATAGCAAAACATAATATTCTATACAGTATCAAGTTTGATGTTTAAAAAAACGCAAGCCCTCTTTGCAAAGGGGCCCACGCGGTGATGCACAATGGGGTGAGATGGATGTTTAAGAGTGCTTAGGCGTGCACAACCGTTTAAAGGTTAGCAACAGCCCTTACACCCCCTGTTATACAATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTC
J.A. Cooper
Public Note:
[Leonard] Like R. roseostipitata except that cap is purple and margin pectinate, gills ochre & flesh is hot. Cap: edge areolate, black in centre, dark violet 17F7. Stipe: with minute scales and fibres. Smell: fishy, FeSO4 green. Spores: echinulate subglobose. Cystidia pleuro fusoid, thick-walled. [Cooper] material does have the sooty cracked cap appearance of R. roseostipitata. Subcutis not pigmented. SV-ve, exiding purple/magenta pigment, forming insolube globules. Without lamellulae. Stem cuticle with bundles of agglutinated galssy, thick-walled hyphae, slightly tan in KOH and with encrustation. Cap cutis a layer of spehrical cells becomeing short elongate at surface, with embedded hairs arsiing from base of sphaerocyst layer 150um deep (grey in KOH) over a disorganised (ixo?) base. Cap hairs to 250um long, often refractive, septate, rounded tips, thick-walled. Basal region of hairs often encrusted. Arising from very disorganised subcutis and not possible to say if cells inflated or not. Evidence suggest not. Gill edge associated with fasicles of cystidia linked to a sub-surface hyphal rope layer. Gill face cystidia much broader and acuminate, terminally refractive, only a few thick-walled. Spores with plage and amyloid spot (violet). Sporeslength=7.6-8.6µm (µ=8.0, σ=0.28), width=6.4-7.2µm (µ=6.8, σ=0.22), Q=1.1-1.2µm (µ=1.18, σ=0.04), n=20, ornamentation to 1.5um. Microscopically nearly identical to R roseostipitata, will be interesting to see what DNA says. Yes - DNA confirms identical to R. roseostipitata.
J.A.Cooper