Systematics Collections Data

PDD 95489 – Gymnopus imbricatus J.A. Cooper & P. Leonard

Data Provider:
New Zealand Fungal and Plant Disease Collection
Barcode:
PDD 95489
Type Status:
Holotype
Specimen Type:
Packet
Loan Status:
Active
Database Record Added:
01 April 2010
Database Record Updated:
03 August 2016
Components
Primary Component
Active Identification
Determined Name:
Gymnopus imbricatus
Determiner:
J.A. Cooper
Determination Date:
2012 (Verbatim: 2012)
Preferred Name:
Gymnopus imbricatus J.A. Cooper & P. Leonard
Phylum:
Basidiomycota
Class:
Agaricomycetes
Order:
Agaricales
Family:
Omphalotaceae
Identification Type:
Determination
Type Status:
Holotype
Associations:
has host Kunzea ericoides
Substrate:
base of live trees
Other Identifications
Identification
Determined Name:
Micromphale sp. 'Lewis Pass (PDD80154)'
Determiner:
J.A. Cooper
Determination Date:
Preferred Name:
Micromphale sp. 'Lewis Pass (PDD 80154)' J.A. Cooper ined.
Phylum:
Basidiomycota
Active:
no
Identification Type:
Determination
Other Components
Active Identification
Determined Name:
Kunzea ericoides
Determiner:
Determination Date:
Preferred Name:
Kunzea ericoides (A.Rich.) Joy Thomps.
Family:
Myrtaceae
Identification Type:
Determination
Present:
no
Collection Events
Primary Collection Event
Collection Event Type:
Unknown
Verbatim Locality:
Kennedy's Bush
Collector:
J.A. Cooper
Collectors Reference No.:
JAC11038
Verbatim Date:
2009/05/24
Start Date:
2009-05-24
Country:
New Zealand
New Zealand Area Codes:
Mid Canterbury
Geo References:
New Zealand Map Grid:   2479775 5730776
Habitat:
Scrub
Keywords:
Scrub
Specimen Notes
Public Note:
garlic smell. Growing from a waxy layer with algal cells. Egon's ZT69/99. With DNA tube. Sequence on the edge of Lewis Pass. length=8.1–11.0µm (µ=9.8, σ=0.82), width=4.6–5.6µm (µ=5.1, σ=0.28), Q=1.7–2.2µm (µ=1.93, σ=0.18), n=20
Public Note:
ITS>TATTGAAACTTCTTTGGAAGTAGTACTGTTGCTGGCCTTGTAATGAGGTA TGTGCACGTACTACTTCTAATCTATTCATCCACCTGTGCACTTATTGTAG GGGTTTTTTGAGGTTAGCTTGTTTGTAGGCTTCGGCTTATGCAGGTTGAC TTTAAAAAGGCTTCTATGTCTTACAAACCTATTGAAGTATGTTTTAGAAT GACATTTATTGGGACTTTACTGGCCCTTTAAACTTRTACAACTTTTAGCA ACGGATCTCTTGGCTCTCCCATCGATGAAGAACGCAGCGAAATGCGATAA GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCT TGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGTGTCATTAAATT CTCAACTTCAAAAGCTTTTATTAGCTTATTGAAGCTTGGATGTGGGGGCT TGCTGGCGTCTTAGATGTTCGGCTCTCCTTAAAGTTATTAGTGGAAATCT CTTTGTTGGGTGATCCTTGGTGTGATAATTATCTACGCTTCGGATGGTCC AATGTTTCCATTGAGGTTGTTCAGTGATGCCCTTGTGGTGTTGCTGGTTT GTAGTACTGCRACTAGTTGCTTTACTTGGGCCTCAGAGGAAAAGGGAAGT TTTGCTCTCTAACTGTCTGTGTTATATGGACAATTTATTGACTATTTGAC CTC
External Links
Assigned Reference Numbers
JA Cooper Fungarium:
JAC11038