Systematics Collections Data

PDD 95459 – Gymnopus ceraceicola J.A. Cooper & P. Leonard

Data Provider:
New Zealand Fungal and Plant Disease Collection
Barcode:
PDD 95459
Type Status:
Paratype
Specimen Type:
Packet
Loan Status:
Active
Database Record Added:
01 April 2010
Database Record Updated:
03 August 2016
Components
Primary Component
Active Identification
Determined Name:
Gymnopus ceraceicola
Determiner:
J.A. Cooper
Determination Date:
2012 (Verbatim: 2012)
Preferred Name:
Gymnopus ceraceicola J.A. Cooper & P. Leonard
Phylum:
Basidiomycota
Class:
Agaricomycetes
Order:
Agaricales
Family:
Omphalotaceae
Identification Type:
Determination
Associations:
has host Nothofagus solandri var. solandri
Substrate:
bark
Other Identifications
Identification
Determined Name:
Micromphale sp. 'Erua Forest (PDD80771)'
Determiner:
J.A. Cooper
Determination Date:
Preferred Name:
Micromphale sp. 'Erua Forest (PDD 80771)' J.A. Cooper ined.
Phylum:
Basidiomycota
Active:
no
Identification Type:
Determination
Other Components
Active Identification
Determined Name:
Nothofagus solandri var. solandri
Determiner:
Determination Date:
Preferred Name:
Nothofagus solandri (Hook.f.) Oerst. var. solandri
Family:
Nothofagaceae
Identification Type:
Determination
Present:
no
Collection Events
Primary Collection Event
Collection Event Type:
Unknown
Gazetteer Locality:
Kowai Bush, Springfield
Verbatim Locality:
Kowai Bush, Springfield
Collector:
J.A. Cooper
Collectors Reference No.:
JAC11005
Verbatim Date:
2009/05/02
Start Date:
2009-05-02
Country:
New Zealand
New Zealand Area Codes:
Mid Canterbury
Geo References:
New Zealand Map Grid:   2422795 5768174
Habitat:
Beech-broadleaved forest
Specimen Notes
Public Note:
garlic smell weak and just noticeable on rubbing. Stem with cystidia. Cap with dark violaceous to the dark brown. No cap surface gelatinsed layer. With DNA tube. Spores length=7.1–8.0µm (µ=7.7, σ=0.4), width=5.3–5.7µm (µ=5.4, σ=0.1), Q=1.3–1.5µm (µ=1.4, σ=0.1), n=10.
Public Note:
ITS>TATTGAAACTTCTTTGGAAGTAGTACTGTTGCTGGCCTTGTAATGAGGTA TGTGCACGTACTATTTCTAATCTATTCATCCACCTGTGCACTTATTGTAG GGGTTTTTTGGGGTTAGCTTGTTGTAGGCTTAGGCTTATGCAGGTTGACT TTAAAAAGGCTTCTATGTCTTACAAACCTATTGAAGTATGTTTTAGAATG TCTTTTATTGGGACTTTATTGGCCCTTTAAACTTATACAACTTTTAGCAA CGGATCTCTTGGCTCTCCCATCGATGAAGAACGCAGCGAAATGCGATAAG TAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTT GCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGTGTCATTAAATTC TCAACTTCAAAAGCTTTTATTAGCTTATTGAAGCTTGGATGTGGGAGCTT GCTGGCGTCTTAGATGTTCGGCTCTCCTTAAAGTTATTAGTGGAAATCTC TTTGTTGGGTGATCCTTGGTGTGATAATTATCTACGCTTCGGATAGTCCA ATGTTTCCATTGAGGTTGTTCAGTAATGCCCTTGTGGTGTTGCTGGTTTG TAGTACTGCAACTAGTTGCTTTACTTGGGCCTCAGAGGAAAAGGGAAGTT TTGCTTTCTAACTGTCTGTGTACATGGACAATTTTATTGACTATTTGACC TCA
External Links
Assigned Reference Numbers
JA Cooper Fungarium:
JAC11005