Systematics Collections Data

PDD 90132 – Gymnopus ceraceicola J.A. Cooper & P. Leonard

Data Provider:
New Zealand Fungal and Plant Disease Collection
Barcode:
PDD 90132
Type Status:
Paratype
Specimen Type:
Packet
Database Record Added:
14 December 2006
Database Record Updated:
03 August 2016
Components
Primary Component
Active Identification
Determined Name:
Gymnopus ceraceicola
Determiner:
J.A. Cooper
Determination Date:
2012 (Verbatim: 2012)
Preferred Name:
Gymnopus ceraceicola J.A. Cooper & P. Leonard
Phylum:
Basidiomycota
Class:
Agaricomycetes
Order:
Agaricales
Family:
Omphalotaceae
Identification Type:
Determination
Other Identifications
Identification
Determined Name:
Micromphale sp. 'Erua Forest (PDD80771)' J.A. Cooper
Determiner:
J.A. Cooper
Determination Date:
2009-10-01 (Verbatim: 2009/10/01)
Preferred Name:
Micromphale sp. 'Erua Forest (PDD 80771)' J.A. Cooper ined.
Phylum:
Basidiomycota
Active:
no
Identification Type:
Determination
Identification
Determined Name:
Micromphale Gray
Determiner:
Determination Date:
Preferred Name:
Micromphale Gray 1821
Phylum:
Basidiomycota
Active:
no
Identification Type:
Determination
Identification
Determined Name:
Micromphale Gray
Determiner:
R.H. Petersen
Determination Date:
Preferred Name:
Micromphale Gray 1821
Phylum:
Basidiomycota
Active:
no
Identification Type:
Determination
Collection Events
Primary Collection Event
Collection Event Type:
Unknown
Gazetteer Locality:
vic. Manapouri, Borland Lodge, Nature Track
Verbatim Locality:
vic. Manapouri, Borland Lodge, Nature Track
Collector:
R.H. Petersen
Collectors Reference No.:
RHP 12871
Verbatim Date:
2006/04/29
Start Date:
2006-04-29
Country:
New Zealand
New Zealand Area Codes:
Fiordland
Geo References:
Latitude and Longitude (Degrees-Minutes):  45°46.575´ S 167°32.226´ E
Specimen Notes
Public Note:
TENN060986. Cap R93, G59, B46, LV10. Stem uniformly dark brown, covered in pale caulocystidia along entire length. Stem base insiticious but slightly swollen. Gills with 2 series of lamellulae, cream, weakly intervenose. Microscopically identical to 10430 & 10429. With DNA tube.
Public Note:
ITS>TATTGAAACTTCTTTGGAAGTAGTACTGTTGCTGGCCTTGTAATGAGGTA TGTGCACGTACTATTTCTAATCTATTCATCCACCTGTGCACTTATTGTAG GGGTTTTTTGGGGTTAGCTTGTTGTAGGCTTCGGCTTATATGCAGGTTGA CTTTAAAAAGGCTTCTATGTCTTACAAACCTATTGAAGTATGTTTTAGAA TGTCTTTTATTGGGACTTTATTGGCCCTTTAAACTTATACAACTTTTAGC AACGGATCTCTTGGCTCTCCCATCGATGAAGAACGCAGCGAAATGCGATA AGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACC TTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGTGTCATTAAAT TCTCAACTTCAAAAGCTTTTATTAGCTTATTGAAGCTTGGATGTGGGGGC TTGCTGGCGTCTTAGATGTTCGGCTCTCCTTAAAGTTATTAGTGGAAATC TCTTTGTTGGGTGATCCTTGGTGTGATAATTATCTACGCTTCGGATAGTC CAATGTTTCCATTGAGGTTGTTCAGTGATGCCCTTGTGGTGTTGCTGGTT TGTAGTACTGCAACTAGTTGCTTTACTTGGGCCTCAGAGGAAAAGGGAAG TTTTGCTTTCTAACTGTCTGTGTACATGGACAATTTTATTGACTATTTGA CCTCAA
External Links
Duplicates
TENN: TENN 060986
Direction:
Received