Systematics Collections Data

PDD 90119 – Gymnopus ceraceicola J.A. Cooper & P. Leonard

Data Provider:
New Zealand Fungal and Plant Disease Collection
Barcode:
PDD 90119
Type Status:
Paratype
Specimen Type:
Packet
Database Record Added:
14 December 2006
Database Record Updated:
03 August 2016
Components
Primary Component
Active Identification
Determined Name:
Gymnopus ceraceicola
Determiner:
J.A. Cooper
Determination Date:
2012 (Verbatim: 2012)
Preferred Name:
Gymnopus ceraceicola J.A. Cooper & P. Leonard
Phylum:
Basidiomycota
Class:
Agaricomycetes
Order:
Agaricales
Family:
Omphalotaceae
Identification Type:
Determination
Other Identifications
Identification
Determined Name:
Micromphale sp. 'Erua Forest (PDD80771)' J.A. Cooper
Determiner:
J.A. Cooper
Determination Date:
2009-10-01 (Verbatim: 2009/10/01)
Preferred Name:
Micromphale sp. 'Erua Forest (PDD 80771)' J.A. Cooper ined.
Phylum:
Basidiomycota
Active:
no
Identification Type:
Determination
Identification
Determined Name:
Micromphale Gray
Determiner:
Determination Date:
Preferred Name:
Micromphale Gray 1821
Phylum:
Basidiomycota
Active:
no
Identification Type:
Determination
Identification
Determined Name:
Micromphale Gray
Determiner:
R.H. Petersen
Determination Date:
Preferred Name:
Micromphale Gray 1821
Phylum:
Basidiomycota
Active:
no
Identification Type:
Determination
Collection Events
Primary Collection Event
Collection Event Type:
Unknown
Gazetteer Locality:
vic. Te Anau, Kepler Track from Rainbow Reach, southern track
Verbatim Locality:
vic. Te Anau, Kepler Track from Rainbow Reach, southern track
Collector:
K.W. Hughes
Collectors Reference No.:
KWH 12891
Verbatim Date:
2006/04/30
Start Date:
2006-04-30
Country:
New Zealand
New Zealand Area Codes:
Fiordland
Geo References:
Latitude and Longitude (Degrees-Minutes):  45°29.509´ S 167°39.822´ E
Specimen Notes
Public Note:
TENN061007. R78, G49, B45,LV 8. Larger than last 3 collections. Gills cream, 1 series of lamellulae, not intervenose. Stem uniformly brown with pale caulocystidia long entire length. Nearly fasiculate. Seems to be associated with yellowish granulose encrustation of bark. Agglutinated caulocystidia with encrsuted granules. Did think these were spores in previous collections - but too small. Cap seems to have a vinaceous tinge. Caulocystidia clamped. Spores length=7.0–8.5µm (µ=7.8, σ=0.7), width=4.4–5.1µm (µ=4.8, σ=0.3), Q=1.5–1.9µm (µ=1.6, σ=0.2), n=4 Possible same as previous 4. With DNA tube.
Public Note:
ITS>TATTGAAACTTCTTTGGAAGTAGTACTGTTGCTGGCCTTGTAATGAGGTA TGTGCACGTACTATTTCTAATCTATTCATCCACCTGTGCACTTATTGTAG GGGTTTTTTGGGGTTAGCTTGTTGTAGGCTTCGGCTTATATGCAGGTTGA CTTTAAAAAGGCTTCTATGTCTTACAAACCTATTGAAGTATGTTTTAGAA TGTCTTTTATTGGGACTTTATTGGCCCTTTAAACTTATACAACTTTTAGC AACGGATCTCTTGGCTCTCCCATCGATGAAGAACGCAGCGAAATGCGATA AGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACC TTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGTGTCATTAAAT TCTCAACTTCAAAAGCTTTTATTAGCTTATTGAAGCTTGGATGTGGGGGC TTGCTGGCGTCTTAGATGTTCGGCTCTCCTTAAAGTTATTAGTGGAAATC TCTTTGTTGGGTGATCCTTGGTGTGATAATTATCTACGCTTCGGATAGTC CAATGTTTCCATTGAGGTTGTTCAGTGATGCCCTTGTGGTGTTGCTGGTT TGTAGTACTGCAACTAGTTGCTTTACTTGGGCCTCAGAGGAAAAGGGAAG TTTTGCTTTCTAACTGTCTGTGTACATGGACAATTTTATTGACTATTTGA CCT
External Links
Duplicates
TENN: TENN 061007
Direction:
Received