Systematics Collections Data

PDD 90101 – Gymnopus ceraceicola J.A. Cooper & P. Leonard

Data Provider:
New Zealand Fungal and Plant Disease Collection
Barcode:
PDD 90101
Type Status:
Paratype
Specimen Type:
Packet
Database Record Added:
14 December 2006
Database Record Updated:
22 September 2016
Components
Primary Component
Active Identification
Determined Name:
Gymnopus ceraceicola
Determiner:
J.A. Cooper
Determination Date:
2012 (Verbatim: 2012)
Preferred Name:
Gymnopus ceraceicola J.A. Cooper & P. Leonard
Phylum:
Basidiomycota
Class:
Agaricomycetes
Order:
Agaricales
Family:
Omphalotaceae
Identification Type:
Determination
Other Identifications
Identification
Determined Name:
Micromphale sp. 'Kennedy's Bush (PDD81086)' J.A. Cooper
Determiner:
J.A. Cooper
Determination Date:
2009-10-01 (Verbatim: 2009/10/01)
Preferred Name:
Micromphale sp. 'Kennedy's Bush (PDD 81086)' J.A. Cooper ined.
Phylum:
Basidiomycota
Active:
no
Identification Type:
Determination
Identification
Determined Name:
Micromphale Gray
Determiner:
Determination Date:
Preferred Name:
Micromphale Gray 1821
Phylum:
Basidiomycota
Active:
no
Identification Type:
Determination
Identification
Determined Name:
Micromphale Gray
Determiner:
R.H. Petersen
Determination Date:
Preferred Name:
Micromphale Gray 1821
Phylum:
Basidiomycota
Active:
no
Identification Type:
Determination
Collection Events
Primary Collection Event
Collection Event Type:
Unknown
Gazetteer Locality:
vic. Seddonville, Charming Creek Track, north end
Verbatim Locality:
vic. Seddonville, Charming Creek Track, north end
Collector:
R.H. Petersen
Collectors Reference No.:
RHP 13063
Verbatim Date:
2006/05/11
Start Date:
2006-05-11
Country:
New Zealand
New Zealand Area Codes:
Nelson
Geo References:
Latitude and Longitude (Degrees-Minutes):  41°35.014´ S 171°57.664´ E
Specimen Notes
Public Note:
TENN 061068. Dried cap color R117, G68, B43, LR15. With 2 series of lamellulae, stem paler at apex and dark brown at base, insiticious (sometimes associated with white chalky patches), laterally compressed in dried material. most with pale caulocystidia but some not. Gills not intervenose, creamy yellow. Cap without any tomentum, even at centre. Cutis hymeniform, with subepidermal dextrinoid layer with extra-celular pigment. Dextrinoid layer extending along base of basidia within gill trama. Trama hyphae interwoven, glassy. Cap tissue gelatinsed. Stem tissue dextrinoid. Caulocystidia forming agglutinated fascicles. Cheilocystidia not seen. Spores inamyloid. Stem tissue clamped. Spores excluding apiculus 6.9-8.5(7.8) SD0.6, n=10 X 4.8-6.3(5.6) SD0.4, n=10. same as 9334 & possibly 9585 group. With DNA tube. Sequence failed. Assumed M. EF, like Ron's other collections.
Public Note:
ITS>GAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGA TCATTATTGAAACTTCTTTGGAAGTAGTACTGTTGCTGGCCTTGTAATGA GGTATGTGCACGTACTATTTCTAATCTATYCATCCACCTGTGCACTTATT GTAGGAGTTTTTTGAGGTTAGCTTGTTGTAGGCTTCGGCTTATGCAGGTT GACTTTAAAAAGGCTTCTATGTCTTACAAACCTATTGAAGTATGTTTTAG AATGTCTTTTATTGGGACTTTATTGGCCCTTTAAACTTGTACAACTTTTA GCAATGGATCTCTTGGCTCTCCCATCGATGAAGAACGCAGCGAAATGCGA TAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCA CCTTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGTGTCATTAA ATTCTCAACTTCAAAAGCTTTTATTAGCTTATTGAAGCTTGGATGTGGGG GCTTGCTGGCGTCTTAGATGTTCGGCTCTCCTTAAAGTTATTAGTGGAAA TCTCTTTGTTGGGTGATCCTTGGTGTGATAATTATCTACGCTTCGGATAG TCCAATGTTTCCATTGAGGTTGTTCAGTGATGCCCTTGTGGTGTTGCTGG TTTGTAGTACTGCAACTAGTTGCTTTACTTGGGCCTCAGAGGAAAAGGGA AGTTTTGCTTTCTAACTGTCTGTGTACATGGACAATTTTATTGACTATTT GACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCA
External Links
Duplicates
TENN: TENN 061068
Direction:
Received