Systematics Collections Data

PDD 87661 – Gymnopus ceraceicola J.A. Cooper & P. Leonard

Data Provider:
New Zealand Fungal and Plant Disease Collection
Barcode:
PDD 87661
Type Status:
Paratype
Specimen Type:
Packet
Loan Status:
Active
Database Record Added:
01 April 2010
Database Record Updated:
03 August 2016
Components
Primary Component
Active Identification
Determined Name:
Gymnopus ceraceicola
Determiner:
J.A. Cooper
Determiner Reference No.:
JAC10817
Determination Date:
2012 (Verbatim: 2012)
Preferred Name:
Gymnopus ceraceicola J.A. Cooper & P. Leonard
Phylum:
Basidiomycota
Class:
Agaricomycetes
Order:
Agaricales
Family:
Omphalotaceae
Identification Type:
Determination
Associations:
has host Leptospermum scoparium
Substrate:
twigs
Other Identifications
Identification
Determined Name:
Micromphale sp. 'Erua Forest (PDD80771)'
Determiner:
J.A. Cooper
Determiner Reference No.:
JAC10817
Determination Date:
Preferred Name:
Micromphale sp. 'Erua Forest (PDD 80771)' J.A. Cooper ined.
Phylum:
Basidiomycota
Active:
no
Identification Type:
Determination
Other Components
Active Identification
Determined Name:
Leptospermum scoparium
Determiner:
Determination Date:
Preferred Name:
Leptospermum scoparium J.R.Forst. & G.Forst.
Family:
Myrtaceae
Identification Type:
Determination
Present:
no
Collection Events
Primary Collection Event
Collection Event Type:
Unknown
Gazetteer Locality:
Government Track, Waipori Falls Road
Verbatim Locality:
Government Track, Waipori Falls Road
Collector:
K. Soop
Verbatim Date:
2008/05/12
Start Date:
2008-05-12
Country:
New Zealand
New Zealand Area Codes:
Dunedin
Geo References:
New Zealand Map Grid:   2282139 5471389
Habitat:
Broadleaved forest
Keywords:
Broadleaved forest
Specimen Notes
Public Note:
same as 10084, but same as 9334? With DNA tube. spores length=8.2–9.2µm (µ=8.7, σ=0.3), width=4.6–5.4µm (µ=5.0, σ=0.2), Q=1.5–1.9µm (µ=1.7, σ=0.1), n=13.
Public Note:
ITS>TATTGAAACTTCTTTGGAAGTAGTACTGTTGCTGGCCTTGTAATGAGGTA TGTGCACGTACTATTTCTAATCTATTCATCCACCTGTGCACTTATTGTAG GAGTTTTTTGAGGTTAGCTTGTTGTAGGCTTAYGGCTTATGCGGGTTGAC TTTAAAAAGGCTTCTATGTCTTACAAACCTATTGAAGTATGTTTTAGAAT GTCTTTTATTGGGACTTTATTGGCCCTTTAAACTTGTACAACTTTTAGCA ACGGATCTCTTGGCTCTCCCATCGATGAAGAACGCAGCGAAATGCGATAA GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCT TGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGTGTCATTAAATT CTCAACTTCAAAAGCTTTTATTAGCTTATTGAAGCTTGGATGTGGGGGCT TGCTGGCGTCTTAGATGTTCGGCTCTCCTTAAAGTTATTAGTGAAAATCT CTTTGTTGGGTGATCCTTGGTGTGATAATTATCTACGCTTCGGATAGTCC AATGTTTCCATTGAGGTTGTTCAGTGATGCCCTTGTGGTGTTGCTGGTTT GTAGTACTGCAACTAGTTGCTTTACTTGGGCCTCAGAGGAAAAGGGAAGT TTTGCTTTCTAACTGTCTGTGTACATGGACAATTTTATTGACTATTTGAC CTC
External Links
Assigned Reference Numbers
JA Cooper Fungarium:
JAC10817