Systematics Collections Data

PDD 87660 – Gymnopus imbricatus J.A. Cooper & P. Leonard

Data Provider:
New Zealand Fungal and Plant Disease Collection
Barcode:
PDD 87660
Type Status:
Paratype
Specimen Type:
Packet
Loan Status:
Active
Database Record Added:
01 April 2010
Database Record Updated:
03 August 2016
Components
Primary Component
Active Identification
Determined Name:
Gymnopus imbricatus
Determiner:
J.A. Cooper
Determiner Reference No.:
JAC10816
Determination Date:
2012 (Verbatim: 2012)
Preferred Name:
Gymnopus imbricatus J.A. Cooper & P. Leonard
Phylum:
Basidiomycota
Class:
Agaricomycetes
Order:
Agaricales
Family:
Omphalotaceae
Identification Type:
Determination
Type Status:
Paratype
Substrate:
fallen log
Other Identifications
Identification
Determined Name:
Micromphale sp. 'Lewis Pass (PDD80154)'
Determiner:
J.A. Cooper
Determiner Reference No.:
JAC10816
Determination Date:
Preferred Name:
Micromphale sp. 'Lewis Pass (PDD 80154)' J.A. Cooper ined.
Phylum:
Basidiomycota
Active:
no
Identification Type:
Determination
Collection Events
Primary Collection Event
Collection Event Type:
Unknown
Gazetteer Locality:
Racemans Track, Silverstream Valley
Verbatim Locality:
Racemans Track, Silverstream Valley
Collector:
S. Dodd
Verbatim Date:
2008/05/13
Start Date:
2008-05-13
Country:
New Zealand
New Zealand Area Codes:
Dunedin
Geo References:
New Zealand Map Grid:   2309600 5485500
Habitat:
kanuka scrub
Specimen Notes
Public Note:
with DNA tube. Sequence on the edge of Lewis Pass.
Public Note:
ITS>TATTGAAACTTCTTTGGAAGTAGTACTGTTGCTGGCCTTGTAATGAGGTA TGTGCACGTACTACTTCTAATCTATTCATCCACCTGTGCACTTATTGTAG GGGTTTTTTGAGGTTAGCTTGTTTGTAGGCTTCGGCTTATGCAGGTTGAC TTTAAAAAGGCTTCTATGTYTTACAAACCTATTGAAGTATGTTTTAGAAT GACATTTATTGGGACTTTACTGGCCCTTTAAACTTATACAACTTTTAGCA ACGGATCTCTTGGCTCTCCCATCGATGAAGAACGCAGCGAAATGCGATAA GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCT TGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGTGTCATTAAATT CTCAACTTCAAAAGCTTTTATTAGCTTATTGAAGCTTGGATGTGGGGGCT TGCTGGCGTCTTAGATGTTCGGCTCTCCTTAAAGTTATTAGTGGAAATCT CTTTGTTGGGTGATCCTTGGTGTGATAATTATCTACGCTTCGGATGGTCC AATGTTTCCATTGAGGTTGTTCAGTGATGCYCTTGTGGTGTTGCTGGTTT GTAGTACTGCAACTAGTTGCTTTACTTGGGCCTCAGAGGAAAAGGGAAGT TTTGCTTTCTAACTGTCTGTGTTATATGGACAATTTATTGACTATTTGAC CTC
External Links
Assigned Reference Numbers
JA Cooper Fungarium:
JAC10816