Systematics Collections Data

PDD 87483 – Gymnopus ceraceicola J.A. Cooper & P. Leonard

Data Provider:
New Zealand Fungal and Plant Disease Collection
Barcode:
PDD 87483
Type Status:
Paratype
Specimen Type:
Packet
Loan Status:
Active
Database Record Added:
01 April 2010
Database Record Updated:
22 September 2016
Components
Primary Component
Active Identification
Determined Name:
Gymnopus ceraceicola
Determiner:
J.A. Cooper
Determiner Reference No.:
JAC10395
Determination Date:
2012 (Verbatim: 2012)
Preferred Name:
Gymnopus ceraceicola J.A. Cooper & P. Leonard
Phylum:
Basidiomycota
Class:
Agaricomycetes
Order:
Agaricales
Family:
Omphalotaceae
Identification Type:
Determination
Substrate:
wood
Other Identifications
Identification
Determined Name:
Micromphale sp. 'Erua Forest (PDD80771)'
Determiner:
J.A. Cooper
Determiner Reference No.:
JAC10395
Determination Date:
Preferred Name:
Micromphale sp. 'Erua Forest (PDD 80771)' J.A. Cooper ined.
Phylum:
Basidiomycota
Active:
no
Identification Type:
Determination
Collection Events
Primary Collection Event
Collection Event Type:
Unknown
Gazetteer Locality:
Mt Holdsworth, Donnelly Flat Loop Track
Verbatim Locality:
Mt Holdsworth, Donnelly Flat Loop Track
Collector:
G. Gates, D. Ratkowsky
Verbatim Date:
2007/05/07
Start Date:
2007-05-07
Country:
New Zealand
New Zealand Area Codes:
Wairarapa
Geo References:
New Zealand Map Grid:   2717653 6030986
Habitat:
podocarp-broadleaved-beech forest
Specimen Notes
Public Note:
Smells fetid when crushed. Same as 9334? And maybe part of a colour continuum with 10336 & 10294? Gill edge fimbriate. Stem dextrinoid, all other tissue inamyloid. Spores length=7.2–8.2µm (µ=7.7, σ=0.4), width=4.4–5.1µm (µ=4.6, σ=0.2), Q=1.5–1.8µm (µ=1.7, σ=0.1), n=7 broadly elliptical. 4-spored. Cheilocystidia cylindrical, slightly broader at apex, 7um diam. Cap thick-walled, glassy, hyphae with extra-cellular pigment and broad clamps. With DNA tube.
Public Note:
ITS>TATTGAAACTTCTTTGGAAGTAGTACTGTTGCTGGCCTTGTAATGAGGTA TGTGCACGTACTATTTCTAATCTATTCATCCACCTGTGCACTTATTGTAG GAGTTTTTTGAGGTTAGCTTGTTGTAGGCTTATGGCTTATGCGGGTTGAC TTTAAAAAGGCTTCTATGTCTTACAAACCTATTGAAGTATGTTTTAGAAT GTCTTTTATTGGGACTTTATTGGCCCTTTAAACTTGTACAACTTTTAGCA ACGGATCTCTTGGCTCTCCCATCGATGAAGAACGCAGCGAAATGCGATAA GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCT TGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGTGTCATTAAATT CTCAACTTCAAAAGCTTTTATTAGCTTATTGAAGCTTGGATGTGGGGGCT TGCTGGCGTCTTAGATGTTCGGCTCTCCTTAAAGTTATTAGTGAAAATCT CTTTGTTGGGTGATCCTTGGTGTGATAATTATCTACGCTTCGGATAGTCC AATGTTTCCATTGAGGTTGTTCAGTGATGCCCTTGTGGTGTTGCTGGTTT GTAGTACTGCAACTAGTTGCTTTACTTGGGCCTCAGAGGAAAAGGGAAGT TTTGCTTTCTAACTGTCTGTGTACATGGACAATTTTATTGACTATTTGAC CTC
External Links
Assigned Reference Numbers
FUNNZ:
FUNNZ2007/1030
JA Cooper Fungarium:
JAC10395