Systematics Collections Data

PDD 87424 – Gymnopus ceraceicola J.A. Cooper & P. Leonard

Data Provider:
New Zealand Fungal and Plant Disease Collection
Barcode:
PDD 87424
Type Status:
Paratype
Specimen Type:
Packet
Loan Status:
Active
Database Record Added:
01 April 2010
Database Record Updated:
03 August 2016
Components
Primary Component
Active Identification
Determined Name:
Gymnopus ceraceicola
Determiner:
J.A. Cooper
Determination Date:
2012 (Verbatim: 2012)
Preferred Name:
Gymnopus ceraceicola J.A. Cooper & P. Leonard
Phylum:
Basidiomycota
Class:
Agaricomycetes
Order:
Agaricales
Family:
Omphalotaceae
Identification Type:
Determination
Associations:
has host Nothofagus
Substrate:
bark
Other Identifications
Identification
Determined Name:
Micromphale sp. 'Mt Holdsworth (PDD87382)'
Determiner:
J.A. Cooper
Determination Date:
Preferred Name:
Micromphale sp. 'Mt Holdsworth (PDD 87382)' J.A. Cooper ined.
Phylum:
Basidiomycota
Active:
no
Identification Type:
Determination
Other Components
Active Identification
Determined Name:
Nothofagus
Determiner:
Determination Date:
Preferred Name:
Nothofagus
Family:
Nothofagaceae
Identification Type:
Determination
Present:
no
Collection Events
Primary Collection Event
Collection Event Type:
Unknown
Gazetteer Locality:
Mt Holdsworth, Gentle Annie Track
Verbatim Locality:
Mt Holdsworth, Gentle Annie Track
Collector:
J.A. Cooper
Collectors Reference No.:
JAC10336
Verbatim Date:
2007/05/11
Start Date:
2007-05-11
Country:
New Zealand
New Zealand Area Codes:
Wairarapa
Geo References:
New Zealand Map Grid:   2717755 6030605
Habitat:
podocarp-broadleaved-beech forest
Specimen Notes
Public Note:
Smelling strongly of rotting cabbage (methyl mercaptan) when crushed. Stem dusted with cheilocystidia. Identical to JAC10294. Cap a bit darker. With DNA tube. Sequence does not adequately separate this from M. H from M. EF.
Public Note:
ITS>TATTGAAACTTCTTTGGAAGTAGTACTGTTGCTGGCCTTGTAATGAGGTA TGTGCACGTACTATTTCTAATCTATCCATCCACCTGTGCACTTATTGTAG GAGTTTTTTGAGGTTAGCTTGTTGTAGGCTTCGGCTTATGCAGGTTGACT TTAAAAAGGCTTCTATGTCTTACAAACCTATTGAAGTATGTTTTAGAATG TCTTTTATTGGGACTTTATTGGCCCTTTAAACTTGTACAACTTTTAGCAA TGGATCTCTTGGCTCTCCCATCGATGAAGAACGCAGCGAAATGCGATAAG TAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTT GCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGTGTCATTAAATTC TCAACTTCAAAAGCTTTTATTAGCTTATTGAAGCTTGGATGTGGGGGCTT GCTGGCGTCTTAGATGTTCGGCTCTCCTTAAAGTTATTAGTGGAAATCTC TTTGTTGGGTGATCCTTGGTGTGATAATTATCTACGCTTCGGATAGTCCA ATGTTTCCATTGAGGTTGTTCAGTGATGCCCTTGTGGTGTTGCTGGTTTG TAGTACTGCAACTAGTTGCTTTACTTGGGCCTCAGAGGAAAAGGGAAGTT TTGCTTTCTAACTGTCTGTGTACATGGACAATTTTATTGACTATTTGACC TCA
External Links
Assigned Reference Numbers
FUNNZ:
FUNNZ2007/0487
JA Cooper Fungarium:
JAC10336