Systematics Collections Data

PDD 87398 – Gymnopus imbricatus J.A. Cooper & P. Leonard

Data Provider:
New Zealand Fungal and Plant Disease Collection
Barcode:
PDD 87398
Type Status:
Paratype
Specimen Type:
Packet
Loan Status:
Active
Database Record Added:
01 April 2010
Database Record Updated:
22 September 2016
Components
Primary Component
Active Identification
Determined Name:
Gymnopus imbricatus
Determiner:
J.A. Cooper
Determination Date:
2012 (Verbatim: 2012)
Preferred Name:
Gymnopus imbricatus J.A. Cooper & P. Leonard
Phylum:
Basidiomycota
Class:
Agaricomycetes
Order:
Agaricales
Family:
Omphalotaceae
Identification Type:
Determination
Associations:
has host Nothofagus
Substrate:
bark on dead branch
Other Identifications
Identification
Determined Name:
Micromphale sp. 'Lyell Walkway (PDD80157)'
Determiner:
J.A. Cooper
Determination Date:
Preferred Name:
Micromphale sp. 'Lyell Walkway (PDD 80157)' J.A. Cooper ined.
Phylum:
Basidiomycota
Active:
no
Identification Type:
Determination
Other Components
Active Identification
Determined Name:
Nothofagus
Determiner:
Determination Date:
Preferred Name:
Nothofagus
Family:
Nothofagaceae
Identification Type:
Determination
Present:
no
Collection Events
Primary Collection Event
Collection Event Type:
Unknown
Gazetteer Locality:
Waiohine Gorge
Verbatim Locality:
Waiohine Gorge
Collector:
J.A. Cooper
Collectors Reference No.:
JAC10310
Verbatim Date:
2007/05/10
Start Date:
2007-05-10
Country:
New Zealand
New Zealand Area Codes:
Wairarapa
Geo References:
New Zealand Map Grid:   2710871 6020861
Habitat:
Beech-broadleaved forest
Specimen Notes
Public Note:
Spores, excluding apiculus 7.2-8.7(7.8) SD0.5, n=10 X 3.8-5.3(4.7) SD0.4, n=10. Band of of sub-cuticular weakly dextrinoid tissue (gelatinised) other wise inamyloid and not dextrinoid, no extra-cellular pigment, clamped. 4-spored. Cheilocystidia not prominent. Stem eccentric, black, no caulocystidia, insiticious, associated with white chalky deposit. Gills with 2-3 sets of lamellulae, creamy/yellow, edge sometimes fimbriate. Cutis ramealis, spores narrower than Petersen's micromphales. Trama partially gelatinised, no dextrinoid content. Basidioles acuminate. Same as 8282? Can this be put in Micromphale given ramealis cap hyphae? See also ZT69/99. With DNA tube. Sequence places this together with M. Lewis Pass.
Public Note:
ITS>TATTGAAACTTCTTTGGAAGTAGTACTGTTGCTGGCCTTGTAATGAGGTA TGTGCACGTACTATTTCTAATCTATTCATCCACCTGTGCACTTATTGTAG GGGTTTTTTGAGGTTAGCTTGTTTGTAGGCTTCGGCTTATGCAGGTTGAC TTTAAAAAGGCTTCTATGTCTTACAAAYCTATTGAAGTATGTTTTAGAAT GACATTTATTGGGACCTTACTGGCCCTTTAAACTTATACAACTTTTAGCA ACGGATCTCTTGGCTCTCCCATCGATGAAGAACGCAGCGAAATGCGATAA GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCT TGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGTGTCATTAAATT CTCAACTTCAAAAGCTTTTATTAGCTTATTGAAGCTTGGATGTGGGGGCT TGCTGGCGTCTTAGATGTTCGGCTCTCCTTAAAGTTATTAGTGGAAATCT CTTTGTTGGGTGATCCTTGGTGTGATAATTATCTACGCTTCGGATGGTCC AATGTTTCCATTGAGGTTGTTCAGTGATGCCCTTGTGGTGTTGCTGGTTT GTAGTACTGCAACTAGTTGCTTTACTTGGGCCTCAGAGGAAAAGGGAAGT TTTGCTTTCTAACTGTCTGTGTTATATGGACAATTTATTGACTATTTGAC CTC
External Links
Assigned Reference Numbers
FUNNZ:
FUNNZ2007/0631
JA Cooper Fungarium:
JAC10310