Systematics Collections Data

PDD 87382 – Gymnopus (Pers.) Roussel

Data Provider:
New Zealand Fungal and Plant Disease Collection
Barcode:
PDD 87382
Type Status:
Paratype
Specimen Type:
Packet
Loan Status:
Active
Database Record Added:
01 April 2010
Database Record Updated:
03 August 2016
Components
Primary Component
Active Identification
Determined Name:
Gymnopus dichrous aff.
Determiner:
J.A. Cooper
Determination Date:
2013 (Verbatim: 2013)
Preferred Name:
Gymnopus (Pers.) Roussel
Phylum:
Basidiomycota
Class:
Agaricomycetes
Order:
Agaricales
Family:
Omphalotaceae
Identification Type:
Determination
Associations:
has host Nothofagus fusca
Substrate:
dead fallen trunk
Other Identifications
Identification
Determined Name:
Micromphale sp. 'Mt Holdsworth (PDD87382)'
Determiner:
J.A. Cooper
Determination Date:
Preferred Name:
Micromphale sp. 'Mt Holdsworth (PDD 87382)' J.A. Cooper ined.
Phylum:
Basidiomycota
Active:
no
Identification Type:
Determination
Identification
Determined Name:
Gymnopus
Determiner:
J.A. Cooper
Determination Date:
2011-12-18 (Verbatim: 18/12/2011)
Preferred Name:
Gymnopus (Pers.) Roussel
Phylum:
Basidiomycota
Active:
no
Identification Type:
Determination
Identification
Determined Name:
Gymnopus ceraceicola J.A. Cooper & P. Leonard
Determiner:
J.A. Cooper
Determination Date:
2012 (Verbatim: 2012)
Preferred Name:
Gymnopus ceraceicola J.A. Cooper & P. Leonard
Phylum:
Basidiomycota
Active:
no
Identification Type:
Determination
Other Components
Active Identification
Determined Name:
Nothofagus fusca
Determiner:
Determination Date:
Preferred Name:
Nothofagus fusca (Hook.f.) Oerst.
Family:
Nothofagaceae
Identification Type:
Determination
Present:
no
Collection Events
Primary Collection Event
Collection Event Type:
Unknown
Gazetteer Locality:
Mt Holdsworth, Gentle Annie Track
Verbatim Locality:
Mt Holdsworth, Gentle Annie Track
Collector:
J.A. Cooper
Collectors Reference No.:
JAC10294
Verbatim Date:
2007/05/11
Start Date:
2007-05-11
Country:
New Zealand
New Zealand Area Codes:
Wairarapa
Geo References:
New Zealand Map Grid:   2717755 6030605
Habitat:
podocarp-broadleaved-beech forest
Specimen Notes
Public Note:
Smell faint. Stem hollow. Gill edge fimbriate. No tissue amyloid or dextrinoid. Clamped. Spores sub-globose 6-8um. Sub-cutis gelatinised. Cap a cutis of broad brown hyphae with extracellular brown zebra pigment and cells with small hyaline finger outgrowths (but these not on every section). Broad layer of partially gelatinised tissue subepidermal. Spore shape quite different to previous collections. Note that cap hyphae are Hydropus-like. Singer's section Micromphale as are others I've labelled Micromphale. See also ZT2071. With DNA tube. Sequence places this remote from the rest of the current NZ Micromphale collections, which appear near G. iocephalus, and very much close to M. foetidum ss. Is not M.f. as does not have dark stem. It is also remote from another collection previously labeled M. Mt Holdsworth which is nested with M. EF. Closer to Marasmiellus omphalodes or G. dichrous. No obvious pleurocystidia.
Public Note:
ITS>TATTGAAACTTCTTTGGAAGTAGTACTGTTGCTGGCCTTGTAATGAGGTA TGTGCACGTACTATTTCTAATCTATTCATCCACCTGTGCACTTATTGTAG GRGTTTTTTGRGGTTAGCTTGTTGTAGGCTTCGGSTTATATGCRGGTTGA CTTTAAAAAGGCTTCTATGTCTTACAAACCTATTGAAGTATGTTTTAGAA TGTCTTTTATTGGGACTTTATTGGCCCTTTAAACTTRTACAACTTTTAGC AACGGATCTCTTGGCTCTCCCATCGATGAAGAACGCAGCGAAATGCGATA AGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACC TTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGTGTCATTAAAT TCTCAACTTCAAAAGCTTTTATTAGCTTATTGAAGCTTGGATGTGGGGGC TTGCTGGCGTCTTAGATGTTCGGCTCTCCTTAAAGTTATTAGTGRAAATC TCTTTGTTGGGTGATCCTTGGTGTGATAATTATCTACGCTTCGGATAGTC CAATGTTTCCATTGAGGTTGTTCAGTGATGCCCTTGTGGTGTTGCTGGTT TGTAGTACTGCAACTAGTTGCTTTACTTGGGCCTCAGAGGAAAAGGGAAG TTTTGCTTTCTAACTGTCTGTGTACATGGACAATTTTATTGACTATTTGA CCTC
External Links
Assigned Reference Numbers
FUNNZ:
FUNNZ2007/0463
JA Cooper Fungarium:
JAC10294