Systematics Collections Data

PDD 87315 – Gymnopus hakaroa J.A. Cooper & P. Leonard

Data Provider:
New Zealand Fungal and Plant Disease Collection
Barcode:
PDD 87315
Type Status:
Holotype
Specimen Type:
Packet
Database Record Added:
01 April 2010
Database Record Updated:
22 September 2016
Components
Primary Component
Active Identification
Determined Name:
Gymnopus hakaroa
Determiner:
J.A. Cooper
Determination Date:
2012 (Verbatim: 2012)
Preferred Name:
Gymnopus hakaroa J.A. Cooper & P. Leonard
Phylum:
Basidiomycota
Class:
Agaricomycetes
Order:
Agaricales
Family:
Omphalotaceae
Identification Type:
Determination
Type Status:
Holotype
Substrate:
dead log
Other Identifications
Identification
Determined Name:
Micromphale sp. 'Kennedy's Bush (PDD81086)'
Determiner:
J.A. Cooper
Determination Date:
Preferred Name:
Micromphale sp. 'Kennedy's Bush (PDD 81086)' J.A. Cooper ined.
Phylum:
Basidiomycota
Active:
no
Identification Type:
Determination
Collection Events
Primary Collection Event
Collection Event Type:
Unknown
Verbatim Locality:
Kennedy's Bush
Collector:
J.A. Cooper
Collectors Reference No.:
JAC10225
Verbatim Date:
2007/02/11
Start Date:
2007-02-11
Country:
New Zealand
New Zealand Area Codes:
Mid Canterbury
Geo References:
New Zealand Map Grid:   2479775 5730776
Altitudes:
from 100m
Habitat:
Mixed indigenous scrub
Keywords:
Mixed indigenous scrub
Specimen Notes
Public Note:
strong fetid smell. Log covered in thousands of fruitbodies. Identical to 9585 and see Egon's ZT69-99. Gill trama and cap surface gelatinised. Subcuticular hyphae a cutis with zebra extra-cellular pigment, no tissue amyloid or dextrinoid, oil droplets forming in melzers, some evidence of spores glued together by resinous exudate (also on cap surface?), spores length=7.7–8.9µm (µ=8.2, σ=0.6), width=4.2–4.5µm (µ=4.3, σ=0.1), Q=1.8–2.1µm (µ=1.9, σ=0.2), n=3 with internal bubbles, cheilocystidia not apparent, tissue clamped. Fruitbodies arising from small hyphal bulbs on waxy subiculum with algae (maybe even lichenised?! - note that strong smelling Marsmiellus affixus from Australia is similarly lichenized, however the smell is described by the Catchesides as ammoniacal). Stem brown at apex, white below in young specimens, all brown in older, minutely pruinose. Note that lichenisation of M. affixus has been questioned by Lepp ... http://www.anbg.gov.au/lichen/case-studies/marasmiellus-affixus.html. Although I believe Singer's evidence is stronger than is given credit, especially when Singer says " some cells of the alga are occasionally found in the trama of the fruiting body". This taxon is a Gymnopus ss antonin and nordeloos. Same as 9585? With DNA tube. Sequence does not adequately separate this from Lewis Pass. Note that even the new concept of Gymnopus is paraphyletic and perhaps the further subsequent necessary splitting may re-establish Micromphale as a well supported group worthy of generic rank. Spores (KOH) length=7.5–9.7µm (µ=8.3, σ=0.68), width=4.4–5.3µm (µ=4.8, σ=0.22), Q=1.5–2.0µm (µ=1.73, σ=0.16), n=20
Public Note:
ITS>GAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA TTATTGAAACTTCTTTGGAAGTAGTACTGTTGCTGGCCTTGTAATGAGGT ATGTGCACGTACTATTTCTAATCTATTCATCCACCTGTGCACTTATTGTA GGGGTTTTTTGAGGTGAGCTTGTTTGTAGGCTTCGGCTTATGCAGGTTGA CTTTAAAAAGGCTTCTATGTCTTACAAACCTATTGAAGTATGTTTAGAAT GACATTTATCGGGACCTTACTGGCCCTTTAAACTTATACAACTTTTAGCA ACGGATCTCTTGGCTCTCCCATCGATGAAGAACGCAGCGAAATGCGATAA GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCT TGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGTGTCATTAAATT CTCAACTTCAAAGGCTTTTATTAGCTTATTGAAGCTTGGATGTGGGGGCT TGCTGGCGTCTTAGATGTTCGGCTCTCCTTAAAGTTATTAGTGGAAATCT CTTTGTTGGGTGATCCTTGGTGTGATAATTATCTACGCTTCGGATGGTCC AATGTTTCCATTGAGGTTGTTCAGTGATGCCCTTGTGGTGTTGCTGGTTT GTAGTACTGCAACTAGTTGCTTTACTTGGGCCTCAGAGGAAAAGGGAAGT TTTGCTTTCTAACTGTCTGTGTTATATGGACAATTTATTGACTATTTGAC CTCAAATCAGGTAGGACTACCCGCTGAACTTAAGC
External Links
Assigned Reference Numbers
JA Cooper Fungarium:
JAC10225