Systematics Collections Data

PDD 87186 – Gymnopus imbricatus J.A. Cooper & P. Leonard

Data Provider:
New Zealand Fungal and Plant Disease Collection
Barcode:
PDD 87186
Type Status:
Paratype
Specimen Type:
Packet
Loan Status:
Active
Database Record Added:
01 April 2010
Database Record Updated:
22 September 2016
Components
Primary Component
Active Identification
Determined Name:
Gymnopus imbricatus
Determiner:
J.A. Cooper
Determination Date:
2012 (Verbatim: 2012)
Preferred Name:
Gymnopus imbricatus J.A. Cooper & P. Leonard
Phylum:
Basidiomycota
Class:
Agaricomycetes
Order:
Agaricales
Family:
Omphalotaceae
Identification Type:
Determination
Type Status:
Paratype
Associations:
has host Kunzea ericoides
Substrate:
standing bark
Other Identifications
Identification
Determined Name:
Micromphale sp. 'Lewis Pass (PDD80154)'
Determiner:
J.A. Cooper
Determination Date:
Preferred Name:
Micromphale sp. 'Lewis Pass (PDD 80154)' J.A. Cooper ined.
Phylum:
Basidiomycota
Active:
no
Identification Type:
Determination
Other Components
Active Identification
Determined Name:
Kunzea ericoides
Determiner:
Determination Date:
Preferred Name:
Kunzea ericoides (A.Rich.) Joy Thomps.
Family:
Myrtaceae
Identification Type:
Determination
Present:
no
Collection Events
Primary Collection Event
Collection Event Type:
Unknown
Gazetteer Locality:
Hinewai Reserve, Akaroa
Verbatim Locality:
Hinewai Reserve, Akaroa
Collector:
J.A. Cooper
Collectors Reference No.:
JAC10089
Verbatim Date:
2006/06/03
Start Date:
2006-06-03
Country:
New Zealand
New Zealand Area Codes:
Mid Canterbury
Geo References:
New Zealand Map Grid:   2511505 5710740
Habitat:
Beech-broadleaved forest
Specimen Notes
Public Note:
smell faintly of rotting cabbage when crushed. Culture white, odourless, clamped. Same as 9329? Spores inamyloid length=8.4–10.8µm (µ=9.9, σ=1.4), width=4.4–5.6µm (µ=5.0, σ=0.6), Q=1.9–2.1µm (µ=2.0, σ=0.1), n=3, 4-spored, layer at base of basidia and before trama weakly dextrinoid. No pleurocystidia, cheilocystidia basidiolar. Tissue with embedded rhomboid crystals, cap surface hyphae with covering of small crystals. Cap tissue partially gelatinised, clamped. With antler-like hyphae in cap. With DNA tube. This should be the pseudotype of M. Lewis Pass
Public Note:
ITS>TATTGAAACTTCTTTGGAAGTAGTACTGTTGCTGGCCTTGTAATGAGGTA TGTGCACGTACTATTTCTAATCTATTCATCCACCTGTGCACTTATTGTAG GGGTTTTTTGAGGTTAGCTTGTTTGTAGGCTTCGGCTTATGCAGGTTGAC TTTAAAAAGGCTTCTATGTCTTACAAACCTATTGAAGTATGTTTTAGAAT GACATTTATTGGGACCTTACTGGCCCTTTAAACTTATACAACTTTTAGCA ACGGATCTCTTGGCTCTCCCATCGATGAAGAACGCAGCGAAATGCGATAA GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCT TGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGTGTCATTAAATT CTCAACTTCAAAAGCTTTTATTAGYTTATTGAAGCTTGGATGTGGGGGCT TGCTGGCGTCTTAGATGTTCGGCTCTCCTTAAAGTTATTAGTGGAAATCT CTTTGTTGGGTGATCCTTGGTGTGATAATTATCTACGCTTCGGATGGTCC AATGTTTCCATTGAGGTTGTTCAGTGATGCCCTTGTGGTGTTGCTGGTTT GTAGTACTGCAACTAGTTGCTTTACTTGGGCCTCAGAGGAAAAGGGAAGT TTTGCTTTCTAACTGTCTGTGTTATATGGACAATTTATTGACTATTTGAC CTC
External Links
Assigned Reference Numbers
JA Cooper Fungarium:
JAC10089