Systematics Collections Data

PDD 87181 – Gymnopus ceraceicola J.A. Cooper & P. Leonard

Data Provider:
New Zealand Fungarium - Te Kohinga Hekaheka o Aotearoa
Barcode:
PDD 87181
Type Status:
Holotype
Specimen Type:
Packet
Database Record Added:
01 April 2010
Database Record Updated:
01 June 2021
Components
Primary Component
Active Identification
Determined Name:
Gymnopus ceraceicola
Determiner:
J.A. Cooper
Determination Date:
2012 (Verbatim: 2012)
Preferred Name:
Gymnopus ceraceicola J.A. Cooper & P. Leonard
Phylum:
Basidiomycota
Class:
Agaricomycetes
Order:
Agaricales
Family:
Omphalotaceae
Identification Type:
Determination
Type Status:
Holotype
Associations:
has host Nothofagus fusca
Substrate:
dead branch
Other Identifications
Identification
Determined Name:
Micromphale sp. 'Erua Forest (PDD80771)'
Determiner:
J.A. Cooper
Determination Date:
Preferred Name:
Gymnopus ceraceicola J.A. Cooper & P. Leonard
Phylum:
Basidiomycota
Active:
no
Identification Type:
Determination
Other Components
Active Identification
Determined Name:
Nothofagus fusca
Determiner:
Determination Date:
Preferred Name:
Fuscospora fusca
Family:
Nothofagaceae
Identification Type:
Determination
Present:
no
Collection Events
Primary Collection Event
Collection Event Type:
Unknown
Standard Locality:
Hinewai Reserve, Akaroa
Verbatim Locality:
Hinewai Reserve, Akaroa
Collector:
J.A. Cooper
Collectors Reference No.:
JAC10084
Verbatim Date:
2006/06/03
Start Date:
2006-06-03
Country:
New Zealand
New Zealand Area Codes:
Mid Canterbury
Altitudes:
from 100m
Habitat:
Beech-broadleaved forest
Specimen Notes
Public Note:
smell of rotting cabbage (but not strong). Gills staining brown. Cap centre minutely felty. Cap with a relativley thick hymenial layer & encrusted gelatinised cutis and subepidermal layer with dextrinoid extracellular pigment, clamped. Caulocystidia entire length of stem. No tissue amyloid or dextrinoid (possible that cap tissue dextrinoid but hard to separate from tissue pigmentation). Cap tissue and gill trama thick-walled. No obvious gill cystidia (basidia like pleuro). Spores inamyloid, length=6.2–8.0µm (µ=7.0, σ=0.7), width=4.1–5.2µm (µ=4.6, σ=0.3), Q=1.3–1.7µm (µ=1.5, σ=0.2), n=6 broadly ellipsoid, asymmetrical, clumping. Caulocystidia clumped. This is clearly same as 9334. Close to 9585 but that with pale stem base. With DNA tube. spores in koh length=7.0–8.8µm (µ=7.9, σ=0.55), width=3.7–5.1µm (µ=4.5, σ=0.38), Q=1.6–2.0µm (µ=1.77, σ=0.09), n=20
Public Note:
ITS>TATTGAAACTTCTTTGGAAGTAGTACTGTTGCTGGCCTTGTAATGAGGTA TGTGCACGTACTATTTCTAATCTATTCATCCACCTGTGCACTTATTGTAG GRGTTTTTTGRGGTTAGCTTGTTGTAGGCTTCGGCTTATGCRGGTTGACT TTAAAAAGGCTTCTATGTCTTACAAACCTATTGAAGTATGTTTTAGAATG TCTTTTATTGGGACTTTATTGGCCCTTTAAACTTRTACAACTTTTAGCAA CGGATCTCTTGGCTCTCCCATCGATGAAGAACGCAGCGAAATGCGATAAG TAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTT GCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGTGTCATTAAATTC TCAACTTCAAAAGCTTTTATTAGCTTATTGAAGCTTGGATGTGGGRGCTT GCTGGCGTCTTAGATGTTCGGCTCTCCTTAAAGTTATTAGTGRAAATCTC TTTGTTGGGTGATCCTTGGTGTGATAATTATCTACGCTTCGGATAGTCCA ATGTTTCCATTGAGGTTGTTCAGTRATGCCCTTGTGGTGTTGCTGGTTTG TAGTACTGCAACTAGTTGCTTTACTTGGGCCTCAGAGGAAAAGGGAAGTT TTGCTTTCTAACTGTCTGTGTACATGGACAATTTTATTGACTATTTGACC TCA
External Links
Assigned Reference Numbers
JA Cooper Fungarium:
JAC10084