Systematics Collections Data

PDD 80771 – Gymnopus ceraceicola J.A. Cooper & P. Leonard

Data Provider:
New Zealand Fungal and Plant Disease Collection
Barcode:
PDD 80771
Type Status:
Paratype
Specimen Type:
Packet
Loan Status:
Active
Database Record Added:
01 April 2010
Database Record Updated:
22 September 2016
Components
Primary Component
Active Identification
Determined Name:
Gymnopus ceraceicola
Determiner:
J.A. Cooper
Determination Date:
2012 (Verbatim: 2012)
Preferred Name:
Gymnopus ceraceicola J.A. Cooper & P. Leonard
Phylum:
Basidiomycota
Class:
Agaricomycetes
Order:
Agaricales
Family:
Omphalotaceae
Identification Type:
Determination
Associations:
has host Beilschmiedia tawa
Other Identifications
Identification
Determined Name:
Micromphale sp. 'Erua Forest (PDD80771)'
Determiner:
J.A. Cooper
Determination Date:
Preferred Name:
Micromphale sp. 'Erua Forest (PDD 80771)' J.A. Cooper ined.
Phylum:
Basidiomycota
Active:
no
Identification Type:
Determination
Other Components
Active Identification
Determined Name:
Beilschmiedia tawa
Determiner:
Determination Date:
Preferred Name:
Beilschmiedia tawa (A.Cunn.) Kirk
Family:
Lauraceae
Identification Type:
Determination
Present:
no
Collection Events
Primary Collection Event
Collection Event Type:
Unknown
Gazetteer Locality:
Erua Forest, near NVS plot.
Verbatim Locality:
Erua Forest, near NVS plot.
Collector:
J.A. Cooper
Collectors Reference No.:
JAC9334
Verbatim Date:
2005/04/04
Start Date:
2005-04-04
Country:
New Zealand
New Zealand Area Codes:
Taupo
Geo References:
New Zealand Map Grid:   2710805 6213805
Habitat:
Broadleaved forest
Keywords:
Broadleaved forest
Specimen Notes
Public Note:
fetid smell when squashed. Fruitbody drying black. Stipe insertion insiticious. With very thick walled odd looking caulocystidia at stem apex, cuticle a cutis with zebra-striped brown dextrinoid encrustation, partially gelatinized, no tissue amyloid, spores elliptic patchily cyanophilous 7.2-8.7(7.8) SD0.5, n=9 x 4.6-5.4(5.0) SD0.3, n=9. Gill trama partially gelatinised, nothing dextrinoid. Acuminate basidioles. Tissue waxy when dried (gills creamy orange). Is associated with chalky layer on bark (and algae?) - is this really extreme bleaching and denudation of lignin content? Very like Micromphale foetidus but with distinctively different caulocystidia. Quite hard to distinguish Marasmiellus from Micromphale. For Singer: rhizomorphs+cuticle ramealis=micromphale,trama gelatinized+no ramealis=micromphale, cuticle ramealis+not gelatinized=marasmiellus. Molecular data doesn't clarify much presently. With DNA tube. This is the pseudotype of M. EF. Similar to M. LP it appears nearest to G. iocephalus which Halling places in its own section (pigments changing in acid/alkali). The current section circumscription doesn't fit the NZ taxa
Public Note:
ITS>TATTGAAACTTCTTTGGAAGTAGTACTGTTGCTGGCCTTGTAATGAGGTA TGTGCACGTACTATTTCTAATCTATTCATCCACCTGTGCACTTATTGTAG GAGTTTTTTGAGGTTAGCTTGTTGTAGGCTTACGGCTTATGCGGGTTGAC TTTAAAAAGGCTTCTATGTCTTACAAACCTATTGAAGTATGTTTTAGAAT GTCTTTTATTGGGACTTTATTGGCCCTTTAAACTTGTACAACTTTTAGCA ACGGATCTCTTGGCTCTCCCATCGATGAAGAACGCAGCGAAATGCGATAA GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCT TGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGTGTCATTAAATT CTCAACTTCAAAAGCTTTTATTAGCTTATTGAAGCTTGGATGTGGGGGCT TGCTGGCGTCTTAGATGTTCGGCTCTCCTTAAAGTTATTAGTGAAAATCT CTTTGTTGGGTGATCCTTGGTGTGATAATTATCTACGCTTCGGATAGTCC AATGTTTCCATTGAGGTTGTTCAGTGATGCCCTTGTGGTGTTGCTGGTTT GTAGTACTGCAACTAGTTGCTTTACTTGGGCCTCAGAGGAAAAGGGAAGT TTTGCTTTCTAACTGTCTGTGTACATGGACAATTTTATTGACTATTTGAC CTC
External Links
Assigned Reference Numbers
FUNNZ:
FUNNZ2005/0500
JA Cooper Fungarium:
JAC9334