Systematics Collections Data

PDD 76358 – Gymnopus ceraceicola J.A. Cooper & P. Leonard

Data Provider:
New Zealand Fungal and Plant Disease Collection
Barcode:
PDD 76358
Type Status:
Paratype
Specimen Type:
Packet
Database Record Added:
23 May 2003
Database Record Updated:
03 August 2016
Components
Primary Component
Active Identification
Determined Name:
Gymnopus ceraceicola
Determiner:
J.A. Cooper
Determination Date:
2012 (Verbatim: 2012)
Preferred Name:
Gymnopus ceraceicola J.A. Cooper & P. Leonard
Phylum:
Basidiomycota
Class:
Agaricomycetes
Order:
Agaricales
Family:
Omphalotaceae
Identification Type:
Determination
Other Identifications
Identification
Determined Name:
Micromphale Gray
Determiner:
P. Leonard
Determination Date:
Preferred Name:
Micromphale Gray 1821
Phylum:
Basidiomycota
Active:
no
Identification Type:
Determination
Identification
Determined Name:
Micromphale sp. 'Erua Forest (PDD80771)' J.A. Cooper
Determiner:
J.A. Cooper
Determination Date:
2012-01-11 (Verbatim: 11/1/2012)
Preferred Name:
Micromphale sp. 'Erua Forest (PDD 80771)' J.A. Cooper ined.
Phylum:
Basidiomycota
Active:
no
Identification Type:
Determination
Collection Events
Primary Collection Event
Collection Event Type:
Unknown
Gazetteer Locality:
Springs Junction, Lake Daniells Track
Verbatim Locality:
Lake Daniells Track
Collector:
P. Leonard
Collectors Reference No.:
PL 189402
Verbatim Date:
2002/04/20
Start Date:
2002-04-20
Country:
New Zealand
New Zealand Area Codes:
Nelson
Geo References:
New Zealand Map Grid:   2449590 5877840
Specimen Notes
Public Note:
identical to preceeding collections. Associated with yellow/cream crustose layer on bark (superficially looks like a lichen). Pat's description: cap convex, snuff brown, a cutis. Gills cream with pink tinge, adnexed. Stipe black, cartilaginous. Smell fetid, cooked cabbage. Attachment insiticious. Spores 8x5um. Stem colour continuous and tomentose.With DNA tube.
Public Note:
ITS>TATTGAAACTTCTTTGGAAGTAGTACTGTTGCTGGCCTTGTAATGAGGTA TGTGCACGTACTATTTCTAATCTATTCATCCACCTGTGCACTTATTGTAG GAGTTTTTTGAGGTTAGCTTGTTGTAGGCTTCGGCTTATGCRGGTTGACT TTAAAAAGGCTTCTATGTCTTACAAACCTATTGAAGTATGTTTTAGAATG TCTTTTATTGGGACTTTATTGGCCCTTTAAACTTRTACAACTTTTAGCAA CGGATCTCTTGGCTCTCCCATCGATGAAGAACGCAGCGAAATGCGATAAG TAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTT GCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGTGTCATTAAATTC TCAACTTCAAAAGCTTTYATTAGCTTATTGAAGCTTGGATGTGGGRGCTT GCTGGCGTCTTAGATGTTCGGCTCTCCTTAAAGTTATTAGTGRAAATCTC TTTGTTGGGTGATCCTTGGTGTGATAATTATCTACGCTTCGGATAGTCCA ATGTTTCCATTGAGGTTGTTCAGTRATGCCCTTGTGGTGTTGCTGGTTTG TAGTACTGCAACTAGTTGCTTTACTTGGGCCTCAGAGGAAAAGGGAAGTT TTGCTTTCTAACTGTCTGTGTACATGGACAATTTTATTGACTATTTGACC TCAAAT
External Links